Flow Cytometry:Article Title: An atypical role for the myeloid receptor Mincle in central nervous system injury
Article Snippet: CD45 Flow cytometry from fixed and perfused tMCAO mouse brains 25-0451-82, eBioscience 1:100 Ly6G 560603, BD Biosciences 1:100 CD11b 557396, BD 1:300 CD11c 17-0114-82, eBioscience 1:100 TNF 554419, BD 1:100 GFAP Spinal cord tissue sectioning and immunofluorescence Spinal cord tissue sectioning and immunofluorescence ab4674, Abcam 1:1600 fibronectin F3648, Sigma-Aldrich 1:200 GFAP Spinal cord tissue sectioning and immunofluorescence in the absence of fibronectin staining Z0334, Dako 1:1000 Rat antiMincle Characterisation of Mincle cell in brain clone 1B6, clone 4A9, D292-3M2, MBL IF mouse antiMincle clone 16E3, ab100846, Abcam IF Arumugam and Manzanero, et al An atypical role for the myeloid receptor Mincle in CNS injury, Supplementary File. alphaSMA clone 1A4, ab7817, Abcam IF CD163 clone ED2, Santa Cruz Biotechnology, sc-59865 IF Iba1 ab5076, Abcam IF Target Forward primer Reverse primer Mouse Clec4e mRNA expression TGCTACAGTGAGGCATCAGG GGTTTTGTGCGAAAAAGGAA Mouse Mip2a mRNA expression GAGACGGGTATCCCTTCGAC TTCAGGGTCAAGGCAAACTT
Immunofluorescence:Article Title: An atypical role for the myeloid receptor Mincle in central nervous system injury
Article Snippet: CD45 Flow cytometry from fixed and perfused tMCAO mouse brains 25-0451-82, eBioscience 1:100 Ly6G 560603, BD Biosciences 1:100 CD11b 557396, BD 1:300 CD11c 17-0114-82, eBioscience 1:100 TNF 554419, BD 1:100 GFAP Spinal cord tissue sectioning and immunofluorescence Spinal cord tissue sectioning and immunofluorescence ab4674, Abcam 1:1600 fibronectin F3648, Sigma-Aldrich 1:200 GFAP Spinal cord tissue sectioning and immunofluorescence in the absence of fibronectin staining Z0334, Dako 1:1000 Rat antiMincle Characterisation of Mincle cell in brain clone 1B6, clone 4A9, D292-3M2, MBL IF mouse antiMincle clone 16E3, ab100846, Abcam IF Arumugam and Manzanero, et al An atypical role for the myeloid receptor Mincle in CNS injury, Supplementary File. alphaSMA clone 1A4, ab7817, Abcam IF CD163 clone ED2, Santa Cruz Biotechnology, sc-59865 IF Iba1 ab5076, Abcam IF Target Forward primer Reverse primer Mouse Clec4e mRNA expression TGCTACAGTGAGGCATCAGG GGTTTTGTGCGAAAAAGGAA Mouse Mip2a mRNA expression GAGACGGGTATCCCTTCGAC TTCAGGGTCAAGGCAAACTT
Staining:Article Title: An atypical role for the myeloid receptor Mincle in central nervous system injury
Article Snippet: CD45 Flow cytometry from fixed and perfused tMCAO mouse brains 25-0451-82, eBioscience 1:100 Ly6G 560603, BD Biosciences 1:100 CD11b 557396, BD 1:300 CD11c 17-0114-82, eBioscience 1:100 TNF 554419, BD 1:100 GFAP Spinal cord tissue sectioning and immunofluorescence Spinal cord tissue sectioning and immunofluorescence ab4674, Abcam 1:1600 fibronectin F3648, Sigma-Aldrich 1:200 GFAP Spinal cord tissue sectioning and immunofluorescence in the absence of fibronectin staining Z0334, Dako 1:1000 Rat antiMincle Characterisation of Mincle cell in brain clone 1B6, clone 4A9, D292-3M2, MBL IF mouse antiMincle clone 16E3, ab100846, Abcam IF Arumugam and Manzanero, et al An atypical role for the myeloid receptor Mincle in CNS injury, Supplementary File. alphaSMA clone 1A4, ab7817, Abcam IF CD163 clone ED2, Santa Cruz Biotechnology, sc-59865 IF Iba1 ab5076, Abcam IF Target Forward primer Reverse primer Mouse Clec4e mRNA expression TGCTACAGTGAGGCATCAGG GGTTTTGTGCGAAAAAGGAA Mouse Mip2a mRNA expression GAGACGGGTATCCCTTCGAC TTCAGGGTCAAGGCAAACTT
Expressing:Article Title: An atypical role for the myeloid receptor Mincle in central nervous system injury
Article Snippet: CD45 Flow cytometry from fixed and perfused tMCAO mouse brains 25-0451-82, eBioscience 1:100 Ly6G 560603, BD Biosciences 1:100 CD11b 557396, BD 1:300 CD11c 17-0114-82, eBioscience 1:100 TNF 554419, BD 1:100 GFAP Spinal cord tissue sectioning and immunofluorescence Spinal cord tissue sectioning and immunofluorescence ab4674, Abcam 1:1600 fibronectin F3648, Sigma-Aldrich 1:200 GFAP Spinal cord tissue sectioning and immunofluorescence in the absence of fibronectin staining Z0334, Dako 1:1000 Rat antiMincle Characterisation of Mincle cell in brain clone 1B6, clone 4A9, D292-3M2, MBL IF mouse antiMincle clone 16E3, ab100846, Abcam IF Arumugam and Manzanero, et al An atypical role for the myeloid receptor Mincle in CNS injury, Supplementary File. alphaSMA clone 1A4, ab7817, Abcam IF CD163 clone ED2, Santa Cruz Biotechnology, sc-59865 IF Iba1 ab5076, Abcam IF Target Forward primer Reverse primer Mouse Clec4e mRNA expression TGCTACAGTGAGGCATCAGG GGTTTTGTGCGAAAAAGGAA Mouse Mip2a mRNA expression GAGACGGGTATCCCTTCGAC TTCAGGGTCAAGGCAAACTT
|
Thermo Fisher is a verified supplier 
Thermo Fisher manufactures this product 